EXER­CÍ­CI­OS DE BI­O­LO­GIA

Superguia Enem - Química e Biologia - - Biologia -

(ENEM 2016 - 2ª APLI­CA­ÇÃO)

1) Cha­ma­mos de li­xo a gran­de di­ver­si­da­de de re­sí­du­os só­li­dos de di­fe­ren­tes pro­ce­dên­ci­as, co­mo os ge­ra­dos em re­si­dên­ci­as. O au­men­to na pro­du­ção de re­sí­du­os só­li­dos le­va à ne­ces­si­da­de de se pen­sar em ma­nei­ras ade­qua­das de tra­ta­men­to. No Bra­sil, 76% do li­xo é dis­pos­to em li­xões e so­men­te 24% tem co­mo des­ti­no um tra­ta­men­to ade­qua­do, con­si­de­ran­do os ater­ros sa­ni­tá­ri­os, as usi­nas de com­pos­ta­gem ou a in­ci­ne­ra­ção.

FADINI, P.S; FADINI, A. A. A. Li­xo: de­sa­fi­os e com­pro­mis­sos. Quí­mi­ca No­va na Es­co­la, maio 2011 (adap­ta­do).

Com­pa­ran­do os tra­ta­men­tos des­cri­tos, as usi­nas de com­pos­ta­gem apre­sen­tam co­mo van­ta­gem se­rem o des­ti­no

a) que ge­ra um pro­du­to pas­sí­vel de uti­li­za­ção na agri­cul­tu­ra.

b) on­de ocor­re a eli­mi­na­ção da ma­té­ria or­gâ­ni­ca pre­sen­te no li­xo.

c) mais ba­ra­to, pois não im­pli­ca cus­tos de tra­ta­men­to nem con­tro­le.

d) que pos­si­bi­li­ta o aces­so de ca­ta­do­res, pe­la dis­po­si­ção do li­xo a céu aber­to.

e) em que se po­dem uti­li­zar áre­as con­ta­mi­na­das com re­sí­du­os de ati­vi­da­des de mi­ne­ra­ção.

2) Darwin, em vi­a­gem às Ilhas Ga­lá­pa­gos, ob­ser­vou que os ten­ti­lhões apre­sen­ta­vam bi­cos com for­ma­tos di­fe­ren­tes em ca­da ilha, de acor­do com o ti­po de ali­men­ta­ção dis­po­ní­vel. La­marck, ao ex­pli­car que o pes­co­ço da gi­ra­fa te­ria es­ti­ca­do pa­ra co­lher fo­lhas e fru­tos no al­to das ár­vo­res, ela­bo­rou idei­as im­por­tan­tes so­bre a evo­lu­ção dos se­res vi­vos.

O tex­to apon­ta que uma ideia co­mum às te­o­ri­as da evo­lu­ção, pro­pos­tas por Darwin e por La­marck, re­fe­re-se à in­te­ra­ção en­tre os or­ga­nis­mos e seus ambientes, que é de­no­mi­na­da de a) mu­ta­ção. b) adap­ta­ção. c) se­le­ção na­tu­ral. d) re­com­bi­na­ção gê­ni­ca. e) va­ri­a­bi­li­da­de ge­né­ti­ca. 3)

Com­pa­nhei­ra vi­a­jan­te

“Su­a­ve­men­te re­ve­la­da? Bem no in­te­ri­or de nos­sas cé­lu­las, uma clan­des­ti­na e es­tra­nha al­ma exis­te. Si­len­ci­o­sa­men­te, ela tra­ma e apa­re­ce cum­prin­do seus afa­ze­res do­més­ti­cos co­ti­di­a­nos, des­co­brin­do seu ni­cho es­pe­ci­al em nos­sa fo­go­sa co­zi­nha me­ta­bó­li­ca, man­ten­do en­tro­pia em apu­ros, em ci­clos va­riá­veis no­tur­nos e diur­nos. Con­tu­do, ra­ra­men­te ela nos acen­de, ape­sar de sua for­na­lha con­su­mi-la. Sua ori­gem? Mi­cro­bi­a­na, su­po­mos. Jul­ga-se adap­ta­da às cé­lu­las eu­ca­ri­on­tes, con­si­de­ran­do-se co­mo es­cra­va — uma ser­va a ser­vi­ço de nos­sa ver­da­dei­ra evo­lu­ção.” McMURRAY, W. C. The tra­ve­ler. Trends in

Bi­o­che­mi­cal Sci­en­ces, 1994 (adap­ta­do). A or­ga­ne­la celular des­cri­ta de for­ma poé­ti­ca no tex­to é o(a) a) cen­trío­lo. b) li­sos­so­mo. c) mi­tocôn­dria d) com­ple­xo gol­gi­en­se. e) re­tí­cu­lo en­do­plas­má­ti­co li­so.

4) Su­po­nha que uma do­en­ça des­co­nhe­ci­da es­te­ja di­zi­man­do um re­ba­nho bo­vi­no de uma ci­da­de e al­guns ve­te­ri­ná­ri­os te­nham con­se­gui­do iso­lar o agen­te cau­sa­dor a do­en­ça, ve­ri­fi­can­do que se tra­ta de um ser uni­ce­lu­lar e pro­ca­ri­on­te.

Pa­ra com­ba­ter a do­en­ça, os ve­te­ri­ná­ri­os de­vem ad­mi­nis­trar, nos bo­vi­nos con­ta­mi­na­dos, a) va­ci­nas. b) an­ti­vi­rais. c) fun­gi­ci­das. d) ver­mí­fu­gos. e) an­ti­bió­ti­cos.

5) O pa­cli­ta­xel é um tri­ter­pe­no po­li-hi­dro­xi­la­do que foi ori­gi­nal­men­te iso­la­do da cas­ca de Ta­xus bre­vi­fo­lia, ár­vo­re de cres­ci­men­to len­to e em ris­co de ex­tin­ção, mas ago­ra é ob­ti­do por ro­ta quí­mi­ca se­mis­sin­té­ti­ca. Es­se fár­ma­co é uti­li­za­do co­mo agen­te qui­mi­o­te­rá­pi­co no tra­ta­men­to de tu­mo­res de ová­rio, ma­ma e pul­mão. Seu mecanismo de ação an­ti-

tu­mo­ral en­vol­ve sua li­ga­ção à tu­bu­li­na in­ter­fe­rin­do com a fun­ção dos mi­cro­tú­bu­los.

KRETZER, I. F. Te­ra­pia an­ti­tu­mo­ral com­bi­na­da de de­ri­va­dos do pa­cli­ta­xel e eto­po­sí­deo as­so­ci­a­dos à na­no­e­mul­são li­pí­di­ca ri­ca em co­les­te­rol - LDE. Dis­po­ní­vel em: www.te­ses.usp.br. Aces­so em: 29 fev. 2012 (adap­ta­do). De acor­do com a ação an­ti­tu­mo­ral des­cri­ta, que fun­ção celular é di­re­ta­men­te afe­ta­da pe­lo pa­cli­ta­xel? a) Di­vi­são celular. b) Trans­por­te pas­si­vo. c) Equei­lí­brio os­mó­ti­co. d) Ge­ra­ção de ener­gia. e) Sín­te­se de pro­teí­nas.

(ENEM 2016 - 1ª APLI­CA­ÇÃO)

6) Ape­sar da gran­de di­ver­si­da­de bi­o­ló­gi­ca, a hipótese de que a vi­da na Ter­ra te­nha ti­do uma úni­ca ori­gem co­mum é acei­ta pe­la co­mu­ni­da­de científica. Uma evi­dên­cia que apoia es­sa hipótese é a ob­ser­va­ção de pro­ces­sos bi­o­ló­gi­cos co­muns a to­dos os se­res vi­vos atu­al­men­te exis­ten­tes.

Um exem­plo de tal pro­ces­so é o(a) a) de­sen­vol­vi­men­to em­bri­o­ná­rio. b) re­pro­du­ção se­xu­a­da. c) res­pi­ra­ção ae­ró­bi­ca. d) ex­cre­ção uri­ná­ria. e) sín­te­se pro­tei­ca.

(ENEM 2015)

7) “A pa­la­vra “bi­o­tec­no­lo­gia” sur­giu no sé­cu­lo XX, quan­do o ci­en­tis­ta Her­bert Bouyer in­tro­du­ziu a in­for­ma­ção res­pon­sá­vel pe­la fa­bri­ca­ção da in­su­li­na hu­ma­na em uma bac­té­ria, pa­ra que ela pas­sas­se a pro­du­zir a subs­tân­cia.”

Dis­po­ní­vel em: www.bra­sil.gov.br. Aces­so em: 28 jun.

2012 (adap­ta­do) As bac­té­ri­as mo­di­fi­ca­das por Her­bert Boyer pas­sa­ram a pro­du­zir in­su­li­na hu­ma­na por­que re­ce­be­ram

a) a sequên­cia de DNA co­di­fi­can­te de in­su­li­na hu­ma­na. b) a pro­teí­na sin­te­ti­za­da por cé­lu­las hu­ma­nas. c) um RNA re­com­bi­nan­te de in­su­li­na hu­ma­na. d) o RNA men­sa­gei­ro de in­su­li­na hu­ma­na. e) um cro­mos­so­mo da es­pé­cie hu­ma­na.

8) “En­tre os anos de 1028 e 1038, Alha­zen (Ibn al-Haytham; 965-1040 d.C.) es­cre­veu sua prin­ci­pal obra, o Li­vro da Ópi­ti­ca, que, com ba­se em ex­pe­ri­men­tos, ex­pli­ca­va o fun­ci­o­na­men­to da vi­são e ou­tros as­péc­tos da óti­ca, por exem­plo, o fun­ci­o­na­men­to da câ­me­ra es­cu­ra. O li­vro foi tra­du­zi­do e in­cor­po­ra­do aos co­nhe­ci­men­tos ci­en­tí­fi­cos oci­den­tais pe­los eu­ro­peus. Na fi­gu­ra, re­ti­ra­da des­sa obra, é re­pre­sen­ta­da a ima­gem in­ver­ti­da de edi­fi­ca­ções em um te­ci­do uti­li­za­do co­mo an­te­pa­ro.”

Se fi­zer­mos uma ana­lo­gia en­tre a ilus­tra­ção e o olho hu­ma­no, o te­ci­do cor­res­pon­de ao(à) a) íris. b) re­ti­na. c) pu­pi­la. d) cór­nea. e) cris­ta­li­no.

9) Os an­fí­bi­os re­pre­sen­tam o pri­mei­ro gru­po de ver­te­bra­dos que, evo­lu­ti­va­men­te, con­quis­tou o am­bi­en­te ter­res­tre. Ape­sar dis­so, a so­bre­vi­vên­cia do gru­po ain­da per­ma­ne­ce res­tri­ta a ambientes úmi­dos ou aquá­ti­cos, de­vi­do à ma­nu­ten­ção de al­gu­mas ca­rac­te­rís­ti­cas fi­si­o­ló­gi­cas re­la­ci­o­na­das à água.

Uma das ca­rac­te­rís­ti­cas a que o tex­to se re­fe­re é a

a) re­pro­du­ção por vi­vi­pa­ri­da­de. b) res­pi­ra­ção pul­mo­nar nos adul­tos. c) re­gu­la­ção tér­mi­ca por en­do­ter­mia. d) co­ber­tu­ra cor­po­ral del­ga­da e al­ta­men­te per­meá­vel. e) lo­co­mo­ção por mem­bros an­te­ri­o­res e pos­te­ri­o­res de­sen­vol­vi­dos.

10) O for­ma­to das cé­lu­las de or­ga­nis­mos plu­ri­ce­lu­la­res é ex­tre­ma­men­te va­ri­a­do. Exis­tem cé­lu­las dis­coi­des, co­mo é o ca­so das he­má­ci­as, as que lem­bram uma es­tre­la, co­mo os neurô­ni­os, e ain­da al­gu­mas alon­ga­das, co­mo as mus­cu­la­res.

Em um mes­mo or­ga­nis­mo, a di­fe­ren­ci­a­ção des­sas cé­lu­las ocor­re por a) pro­du­zi­rem mu­ta­ções es­pe­cí­fi­cas. b) pos­suí­rem DNA mi­to­con­dri­al di­fe­ren­tes. c) apre­sen­ta­rem con­jun­to de ge­nes dis­tin­tos. d) ex­pres­sa­rem por­ções dis­tin­tas do ge­no­ma. e) te­rem um nú­me­ro dis­tin­to de cro­mos­so­mos.

11) Nor­mal­men­te, as cé­lu­las do or­ga­nis­mo hu­ma­no re­a­li­zam a res­pi­ra­ção ae­ró­bi­ca, na qual o con­su­mo de uma molécula de gli­co­se ge­ra 38 mo­lé­cu­las de ATP. Con­tu­do, em con­di­ções ana­e­ró­bi­cas, o con­su­mo de uma molécula de gli­co­se pe­las cé­lu­las é ca­paz de ge­rar ape­nas du­as mo­lé­cu­las de ATP.

Qual cur­va re­pre­sen­ta o per­fil de con­su­mo de gli­co­se, pa­ra ma­nu­ten­ção da ho­me­os­ta­se de uma cé­lu­la que ini­ci­al­men­te es­tá em uma con­di­ção ana­e­ró­bi­ca e é sub­me­ti­da a um au­men­to gra­du­al da con­cen­tra­ção de oxi­gê­nio?

a) 1 b) 2 c) 3 d) 4 e) 5

(FUVEST 2017)

12)

Pro­cu­ran­do bem

To­do mun­do tem pe­re­ba

Mar­ca de be­xi­ga ou va­ci­na

E tem pi­ri­ri, tem lom­bri­ga, tem ame­ba

Só a bai­la­ri­na que não tem

Edu Lo­bo e Chi­co Bu­ar­que, Ci­ran­da da bai­la­ri­na.

A bai­la­ri­na dos ver­sos não con­trai as do­en­ças cau­sa­das por dois pa­ra­si­tas de im­por­tân­cia pa­ra a saú­de pú­bli­ca: a lom­bri­ga ( As­ca­ris lum­bri­coi­des) e a ame­ba ( En­ta­mo­e­ba his­toly­ti­ca). To­do mun­do, po­rém, po­de-se pre­ve­nir con­tra es­sas pa­ra­si­to­ses, quan­do

a) não na­da em la­gos em que ha­ja ca­ra­mu­jos e pos­si­bi­li­da­de de con­ta­mi­na­ção com es­go­to.

b) la­va mui­to bem ve­ge­tais e fru­tas an­tes de in­ge­ri-los crus.

c) uti­li­za cal­ça­dos ao an­dar so­bre so­los em que ha­ja pos­si­bi­li­da­de de con­ta­mi­na­ção com es­go­to.

d) evi­ta pi­ca­da de ar­tró­po­des que trans­mi­tem es­ses pa­ra­si­tas.

e) não in­ge­re car­ne bo­vi­na ou suí­na con­ta­mi­na­da pe­los ovos da lom­bri­ga e da ame­ba.

13) Nos he­re­do­gra­mas apre­sen­ta­dos nas al­ter­na­ti­vas, ocor­rem pes­so­as que têm al­te­ra­ções na for­ma­ção do es­mal­te dos den­tes ([sím­bo­lo qua­dra­do pre­en­chi­do] e [sím­bo­lo cír­cu­lo pre­en­chi­do]). Os he­re­do­gra­mas em que as al­te­ra­ções do es­mal­te dos den­tes têm he­ran­ça li­ga­da ao cro­mos­so­mo X, do­mi­nan­te e re­ces­si­va, es­tão re­pre­sen­ta­dos, res­pec­ti­va­men­te, em

14) As­si­na­le a al­ter­na­ti­va que or­de­na cor­re­ta­men­te três no­vi­da­des evo­lu­ti­vas, de acor­do com o seu sur­gi­men­to no pro­ces­so de evo­lu­ção das plan­tas ter­res­tres. a) Sis­te­ma vas­cu­lar, se­men­te, flor. b) Sis­te­ma vas­cu­lar, flor, se­men­te. c) Se­men­te, sis­te­ma vas­cu­lar, flor. d) Se­men­te, flor, sis­te­ma vas­cu­lar. e) Flor, sis­te­ma vas­cu­lar, se­men­te.

(UNESP 2017)

15) Em uma ma­té­ria so­bre o pa­pel das plan­tas na re­du­ção da con­cen­tra­ção at­mos­fé­ri­ca dos ga­ses do efei­to es­tu­fa, cons­ta a se­guin­te in­for­ma­ção:

“O ve­ge­tal `ar­ran­ca’ o car­bo­no, que é o C do CO2, pa­ra usar de ma­té­ria-pri­ma pa­ra o seu tron­co, e de­vol­ve pa­ra a at­mos­fe­ra o O2, ou se­ja, oxi­gê­nio.”

( Su­pe­rin­te­res­san­te, maio de 2016. Adap­ta­do.) Tal in­for­ma­ção re­fe­re-se à a) res­pi­ra­ção celular e es­tá cor­re­ta, uma vez que, nas mi­tocôn­dri­as, o car­bo­no do CO2 é dis­po­ni­bi­li­za­do pa­ra a sín­te­se de te­ci­dos ve­ge­tais e o O2 é de­vol­vi­do pa­ra a at­mos­fe­ra.

b) fo­tos­sín­te­se e es­tá cor­re­ta, uma vez que, atra­vés des­se pro­ces­so, a plan­ta uti­li­za o car­bo­no na sín­te­se de seus te­ci­dos, de­vol­ven­do pa­ra a at­mos­fe­ra o oxi­gê­nio do CO2.

c) fo­tos­sín­te­se e es­tá in­cor­re­ta, uma vez que o car­bo­no do CO2 é uti­li­za­do na sín­te­se de car­boi­dra­tos que se­rão con­su­mi­dos na res­pi­ra­ção celular, mas não co­mo ma­té­ria-pri­ma do tron­co.

d) fo­tos­sín­te­se e es­tá in­cor­re­ta, uma vez que o oxi­gê­nio li­be­ra­do pa­ra a at­mos­fe­ra pro­vém da re­a­ção de de­com­po­si­ção da água, e não do CO2 que a plan­ta cap­ta da at­mos­fe­ra.

e) res­pi­ra­ção celular e es­tá in­cor­re­ta, uma vez que o O2 li­be­ra­do pa­ra at­mos­fe­ra tem ori­gem na que­bra de car­boi­dra­tos na gli­có­li­se, da qual tam­bém re­sul­ta o car­bo­no que irá com­por os te­ci­dos ve­ge­tais.

16) Uma pro­fes­so­ra de Bi­o­lo­gia ex­pli­ca­va a seus alu­nos que o dal­to­nis­mo pa­ra a cor ver­de é de­ter­mi­na­do por um ge­ne re­ces­si­vo li­ga­do ao se­xo. Pau­lo e Luí­sa, um ca­sal de gê­me­os que es­tu­da­va na mes­ma sa­la, dis­se­ram que eram daltô­ni­cos pa­ra a cor ver­de. A pro­fes­so­ra per­gun­tou se ou­tras pes­so­as da fa­mí­lia tam­bém eram daltô­ni­cas e os gê­me­os res­pon­de­ram que ou­tras du­as pes­so­as ti­nham o mes­mo ti­po de dal­to­nis­mo. Pa­ra des­co­brir quais eram es­sas pes­so­as, a pro­fes­so­ra fez mais al­gu­mas per­gun­tas aos gê­me­os e des­co­briu que eles não ti­nham ou­tros ir­mãos, que seus pais eram fi­lhos úni­cos e que seus avós ain­da eram vi­vos.

As ou­tras du­as pes­so­as daltô­ni­cas da fa­mí­lia eram a) o pai e o avô ma­ter­no dos gê­me­os. b) a mãe e a avó ma­ter­na dos gê­me­os. c) a mãe e a avó pa­ter­na dos gê­me­os. d) o pai e a mãe dos gê­me­os. e) o avô ma­ter­no e a avó pa­ter­na dos gê­me­os.

(ENEM 2016 - 1ª APLI­CA­ÇÃO)

17) A co­le­ta das fe­zes dos ani­mais do­més­ti­cos em sa­co­las plás­ti­cas e o seu des­car­te em li­xei­ras con­ven­ci­o­nais po­dem cri­ar con­di­ções de de­gra­da­ção que ge­ram pro­du­tos pre­ju­di­ci­ais ao meio am­bi­en­te (Fi­gu­ra 1).

A Fi­gu­ra 2 ilus­tra o Pro­je­to Park Spark, de­sen­vol­vi­do em Cam­brid­ge, MA (EUA), em que as fe­zes dos ani­mais do­més­ti­cos são re­co­lhi­das em sa­co­las bi­o­de­gra­dá­veis e jo­ga­das em um bi­o­di­ges­tor ins­ta­la-

do em par­ques pú­bli­cos; e os pro­du­tos são uti­li­za­dos em equi­pa­men­tos no pró­prio par­que.

Uma ino­va­ção des­se pro­je­to é pos­si­bi­li­tar o(a) a) quei­ma de gás me­ta­no. b) ar­ma­ze­na­men­to de gás carbô­ni­co. c) de­com­po­si­ção ae­ró­bi­ca das fe­zes. d) uso mais efi­ci­en­te de com­bus­tí­veis fós­seis. e) fi­xa­ção de car­bo­no em mo­lé­cu­las or­gâ­ni­cas.

18) O es­que­ma re­pre­sen­ta, de ma­nei­ra sim­pli­fi­ca­da, o pro­ces­so de pro­du­ção de eta­nol uti­li­zan­do mi­lho co­mo ma­té­ria-pri­ma.

A eta­pa de hi­dró­li­se na pro­du­ção de eta­nol a par­tir do mi­lho é fun­da­men­tal pa­ra que a) a gli­co­se se­ja con­ver­ti­da em sa­ca­ro­se. b) as en­zi­mas des­sa plan­ta se­jam ati­va­das. c) a ma­ce­ra­ção fa­vo­re­ça a so­lu­bi­li­za­ção em água. d) o ami­do se­ja trans­for­ma­do em subs­tra­tos uti­li­zá­veis pe­la le­ve­du­ra.

e) os grãos com di­fe­ren­tes com­po­si­ções quí­mi­cas se­jam pa­dro­ni­za­dos.

19) As pro­teí­nas de uma cé­lu­la eucariótica pos­su­em pep­tí­de­os si­nais, que são sequên­ci­as de ami­noá­ci­dos res­pon­sá­veis pe­lo seu en­de­re­ça­men­to pa­ra as di­fe­ren­tes or­ga­ne­las, de acor­do com su­as fun­ções. Um pes­qui­sa­dor de­sen­vol­veu uma na­no­par­tí­cu­la ca­paz de car­re­gar pro­teí­nas pa­ra den­tro de ti­pos ce­lu­la­res es­pe­cí­fi­cos. Ago­ra ele quer sa­ber se uma na­no­par­tí­cu­la car­re­ga­da com uma pro­teí­na blo­que­a­do­ra do ci­clo de Krebs in vi­tro é ca­paz de exer­cer sua ati­vi­da­de em uma cé­lu­la can­ce­ro­sa, po­den­do cor­tar o apor­te ener­gé­ti­co e des­truir es­sas cé­lu­las.

Ao es­co­lher es­sa pro­teí­na blo­que­a­do­ra pa­ra car­re­gar as na­no­par­tí­cu­las, o pes­qui­sa­dor de­ve le­var em con­ta um pep­tí­deo si­nal de en­de­re­ça­men­to pa­ra qual or­ga­ne­la? a) Nú­cleo. b) Mi­tocôn­dria. c) Pe­ro­xis­so­mo. d) Com­ple­xo gol­gi­en­se. e) Re­tí­cu­lo en­do­plas­má­ti­co.

20) Um pes­qui­sa­dor in­ves­ti­gou o pa­pel da pre­da­ção por pei­xes na den­si­da­de e ta­ma­nho das pre­sas, co­mo pos­sí­vel con­tro­le de po­pu­la­ções de es­pé­ci­es exó­ti­cas em cos­tões ro­cho­sos. No ex­pe­ri­men­to, co­lo­cou uma te­la so­bre uma área da co­mu­ni­da­de, im­pe­din­do o aces­so dos pei­xes ao ali­men­to e com­pa­rou o re­sul­ta­do com uma área ad­ja­cen­te na qual os pei­xes ti­nham aces­so li­vre. O qua­dro apre­sen­ta os re­sul­ta­dos en­con­tra­dos após 15 di­as de ex­pe­ri­men­to.

O pes­qui­sa­dor con­cluiu cor­re­ta­men­te que os pei­xes con­tro­lam a den­si­da­de dos(as) a) al­gas, es­ti­mu­lan­do seu cres­ci­men­to. b) cra­cas, pre­dan­do es­pe­ci­al­men­te ani­mais pe­que­nos.

c) me­xi­lhões, pre­dan­do es­pe­ci­al­men­te ani­mais pe­que­nos.

d) qu­a­tro es­pé­ci­es tes­ta­das, pre­dan­do in­di­ví­du­os pe­que­nos.

e) as­cí­di­as, ape­sar de não re­pre­sen­ta­rem os me­no­res or­ga­nis­mos.

21) Ao per­cor­rer o tra­je­to de uma ca­deia ali­men­tar, o car­bo­no, ele­men­to es­sen­ci­al e ma­jo­ri­tá­rio da ma­té­ria or­gâ­ni­ca que com­põe os in­di­ví­du­os, ora se en­con­tra em sua for­ma inor­gâ­ni­ca, ora se en­con­tra em sua for­ma or­gâ­ni­ca. Em uma ca­deia ali­men­tar com­pos­ta por fi­to­plânc­ton, zo­o­plânc­ton, mo­lus­cos, crus­tá­ce­os e pei­xes ocor­re a tran­si­ção des­se ele­men­to da for­ma inor­gâ­ni­ca pa­ra a or­gâ­ni­ca.

Em qual gru­po de or­ga­nis­mos ocor­re es­sa tran­si­ção? a) Fi­to­plânc­ton b) Zo­o­plânc­ton. c) Mo­lus­cos. d) Crus­tá­ce­os. e) Pei­xes.

22) A for­ma­ção de coá­gu­los san­guí­ne­os em vei­as e ar­té­ri­as é um dos fa­to­res res­pon­sá­veis pe­la ocor­rên­cia de do­en­ças car­di­o­vas­cu­la­res, co­mo va­ri­zes, in­far­to e aci­den­tes vas­cu­la­res ce­re­brais. A pre­ven­ção e o tra­ta­men­to des­sas do­en­ças po­dem ser fei­tos com dro­gas an­ti­co­a­gu­lan­tes. A in­dús­tria far­ma­cêu­ti­ca es­ti­mu­la a pes­qui­sa de to­xi­nas ani­mais com es­sa pro­pri­e­da­de.

Con­si­de­ran­do as adap­ta­ções re­la­ci­o­na­das aos há­bi­tos ali­men­ta­res, os ani­mais adequados ao pro­pó­si­to des­sas pes­qui­sas são os(as) a) mo­lus­cos fi­tó­fa­gos. b) mos­cas sa­pró­fa­gas. c) pás­sa­ros car­ní­vo­ros. d) mor­ce­gos fru­gí­vo­ros. e) mos­qui­tos he­ma­tó­fa­gos.

23) “Re­cen­te­men­te um es­tu­do fei­to em cam­pos de tri­go mos­trou que ní­veis ele­va­dos de dió­xi­do de car­bo­no na at­mos­fe­ra pre­ju­di­cam a ab­sor­ção de ni- tra­to pe­las plan­tas. Con­se­quen­te­men­te, a qua­li­da­de nu­tri­ci­o­nal des­ses ali­men­tos po­de di­mi­nuir à me­di­da que os ní­veis de dió­xi­do de car­bo­no na at­mos­fe­ra atin­gi­rem as es­ti­ma­ti­vas pa­ra as pró­xi­mas dé­ca­das.”

BLOOM, A. J. et al. Ni­tra­te as­si­mi­la­ti­on is inhi­bi­ted by ele­va­ted CO2 in fi­eld-grown whe­at. Na­tu­re Cli­ma­te

Chan­ge, n. 4 abr. 2014 (adap­ta­do) Nes­se con­tex­to, a qua­li­da­de nu­tri­ci­o­nal do grão de tri­go se­rá mo­di­fi­ca­da pri­ma­ri­a­men­te pe­la re­du­ção de a) ami­do. b) fru­to­se. c) li­pí­de­os. d) ce­lu­lo­se. e) pro­teí­nas.

24) A ve­ge­ta­ção apre­sen­ta adap­ta­ções ao am­bi­en­te, co­mo plan­tas ar­bó­re­as e ar­bus­ti­vas com raí­zes que se ex­pan­dem ho­ri­zon­tal­men­te, per­mi­tin­do for­te an­co­ra­gem no subs­tra­to la­ma­cen­to; raí­zes que se ex­pan­dem ver­ti­cal­men­te, por cau­sa da bai­xa oxi­ge­na­ção do subs­tra­to; fo­lhas que têm glân­du­las pa­ra eli­mi­nar o ex­ces­so de sais; fo­lhas que po­dem apre­sen­tar cu­tí­cu­la es­pes­sa pa­ra re­du­zir a per­da de água por eva­po­ra­ção.

As ca­rac­te­rís­ti­cas des­cri­tas re­fe­rem-se a plan­tas adap­ta­das ao bi­o­ma: a) Cer­ra­do. b) Pam­pas. c) Pan­ta­nal. d) Man­gue­zal. e) Ma­ta de Co­cais.

25) Os ecos­sis­te­mas de­gra­da­dos por in­ten­sa ati­vi­da­de agrí­co­la apre­sen­tam, ge­ral­men­te, di­mi­nui­ção de sua di­ver­si­da­de e per­da de sua es­ta­bi­li­da­de. Nes­se con­tex­to, o uso in­te­gra­do de ár­vo­res aos sis­te­mas agrí­co­las (sis­te­mas agro­flo­res­tas) po­de cum­prir um pa­pel ino­va­dor ao bus­car a ace­le­ra­ção do pro­ces­so su­ces­si­o­nal e, ao mes­mo tem­po, uma pro­du­ção es­ca­lo­na­da e di­ver­si­fi­ca­da.

Dis­po­ní­vel em: saf.cnpgc.em­bra­pa.br. Aces­so em: 21

jan. 2012 (adap­ta­do).

Es­sa é uma es­tra­té­gia de con­ci­li­a­ção en­tre re­cu­pe­ra­ção am­bi­en­tal e pro­du­ção agrí­co­la, pois a) subs­ti­tui gra­da­ti­va­men­te as es­pé­ci­es cul­ti­vá­veis por es­pé­ci­es ar­bó­re­as. b) in­ten­si­fi­ca a fer­ti­li­za­ção do so­lo com o uso de téc­ni­cas apro­pri­a­das e bi­o­ci­das. c) pro­mo­ve mai­or di­ver­si­da­de de vi­da no so­lo com o au­men­to da ma­té­ria or­gâ­ni­ca. d) fa­vo­re­ce a dis­per­são das se­men­tes cul­ti­va­das pe­la fau­na re­si­den­te nas áre­as flo­res­tais. e) cria con­di­ções pa­ra o es­ta­be­le­ci­men­to de es­pé­ci­es pi­o­nei­ras com a di­mi­nui­ção da in­so­la­ção so­bre o so­lo.

26) A fi­gu­ra ilus­tra o mo­vi­men­to da sei­va xi­lê­mi­ca em uma plan­ta.

Mes­mo que es­sa plan­ta vi­es­se a so­frer ação con­tí­nua do ven­to e sua co­pa cres­ces­se vol­ta­da pa­ra bai­xo, es­sa sei­va con­ti­nu­a­ria na­tu­ral­men­te seu per­cur­so.

O que ga­ran­te o trans­por­te des­sa sei­va é a a) gu­ta­ção. b) gra­vi­da­de. c) res­pi­ra­ção. d) fo­tos­sín­te­se. e) trans­pi­ra­ção.

27) Vá­ri­os mé­to­dos são em­pre­ga­dos pa­ra pre­ven­ção de in­fec­ções por mi­cror­ga­nis­mos. Dois des­ses mé­to­dos uti­li­zam mi­cror­ga­nis­mos vi­vos e são eles: as va­ci­nas ate­nu­a­das, cons­ti­tuí­das por pa­tó­ge­nos avi­ru­len­tos, e os pro­bió­ti­cos que con­têm bac­té­ri­as be­né­fi­cas. Na fi­gu­ra são apre­sen­ta­dos cin­co di­fe­ren­tes me­ca­nis­mos de ex­clu­são de pa­tó­ge­nos pe­la ação dos pro­bió­ti­cos no in­tes­ti­no de um ani­mal.

Qual mecanismo de ação des­ses pro­bió­ti­cos pro­mo­ve um efei­to si­mi­lar ao da va­ci­na? a) 5 b) 4 c) 3 d) 2 e) 1

28) “O Pai­nel In­ter­go­ver­na­men­tal de Mu­dan­ças Cli­má­ti­cas (na si­gla em in­glês, IPCc) pre­vê que nas pró­xi­mas dé­ca­das o pla­ne­ta pas­sa­rá por mu­dan­ças cli­má­ti­cas e pro­põe es­tra­té­gi­as de mi­ti­ga­ção e adap­ta­ção a elas. As es­tra­té­gi­as de mi­ti­ga­ção são di­re­ci­o­na­das à cau­sa des­sas mu­dan­ças, pro­cu­ran­do re­du­zir a con­cen­tra­ção de ga­ses de efei­to es­tu­fa na at­mos­fe­ra. As es­tra­té­gi­as de adap­ta­ção, por sua vez, são di­re­ci­o­na­das aos efei­tos des­sas mu­dan­ças, pro­cu­ran­do pre­pa­rar os sis­te­mas hu­ma­nos às mu­dan­ças cli­má­ti­cas já em an­da­men­to, de mo­do a re­du­zir seus efei­tos ne­ga­ti­vos.”

Con­si­de­ran­do as in­for­ma­ções do tex­to, qual ação re­pre­sen­ta uma es­tra­té­gia de adap­ta­ção? a) Cons­tru­ção de usi­nas eó­li­cas. b) Tra­ta­men­to de re­sí­du­os só­li­dos. c) Au­men­to da efi­ci­ên­cia dos veí­cu­los. d) Ado­ção de agri­cul­tu­ra sus­ten­tá­vel de bai­xo car­bo­no.

e) Cri­a­ção de di­ques de con­ten­ção em re­giões cos­tei­ras.

29) “O Bra­sil pos­sui um gran­de nú­me­ro de es­pé­ci­es dis­tin­tas en­tre ani­mais, ve­ge­tais e mi­cror­ga­nis­mos en­vol­tos em uma imen­sa com­ple­xi­da­de e dis­tri­buí­das em uma gran­de va­ri­e­da­de de ecos­sis­te­mas.”

O in­cre­men­to da va­ri­a­bi­li­da­de ocor­re em ra­zão da per­mu­ta ge­né­ti­ca, a qual pro­pi­cia a tro­ca de seg­men­tos en­tre cro­má­ti­des não ir­mãs na mei­o­se.

Es­sa tro­ca de seg­men­tos é de­ter­mi­nan­te na a) pro­du­ção de in­di­ví­du­os mais fér­teis. b) transmissão de no­vas ca­rac­te­rís­ti­cas ad­qui­ri­das. c) re­com­bi­na­ção ge­né­ti­ca na for­ma­ção dos ga­me­tas. d) ocor­rên­cia de mu­ta­ções so­má­ti­cas nos des­cen­den­tes.

e) va­ri­a­ção do nú­me­ro de cro­mos­so­mos ca­rac­te­rís­ti­co da es­pé­cie.

30) Por­ta­do­res de di­a­be­tes in­si­pi­dus re­cla­mam da con­fu­são fei­ta pe­los pro­fis­si­o­nais da saú­de quan­to aos dois ti­pos de di­a­be­tes: mi­el­li­tus e in­si­pi­dus. En­quan­to o pri­mei­ro ti­po es­tá as­so­ci­a­do aos ní­veis ou à ação da in­su­li­na, o se­gun­do não es­tá li­ga­do à de­fi­ci­ên­cia des­se hormô­nio. O di­a­be­tes in­si­pi­dus é ca­rac­te­ri­za­do por um dis­túr­bio na pro­du­ção ou no fun­ci­o­na­men­to do hormô­nio an­ti­diu­ré­ti­co (na si­gla em in­glês, ADH), se­cre­ta­do pe­la neu­ro-hi­pó­fi­se pa­ra con­tro­lar a re­ab­sor­ção de água pe­los tú­bu­los re­nais.

Ten­do em vis­ta o pa­pel fun­ci­o­nal do ADH, qual é um sin­to­ma clás­si­co de um pa­ci­en­te aco­me­ti­do por di­a­be­tes in­si­pi­dus?

a) Al­ta ta­xa de gli­co­se no san­gue. b) Au­men­to da pres­são ar­te­ri­al. c) Ga­nho de mas­sa cor­po­ral. d) Ane­mia crô­ni­ca. e) De­si­dra­ta­ção.

(UNICAMP 2017)

31) Pes­qui­sa­do­res ana­li­sa­ram o nú­me­ro de po­li­ni­za­do­res, a bi­o­di­ver­si­da­de e o ren­di­men­to de cul­ti­vos de­pen­den­tes de po­li­ni­za­do­res (ma­çã, pe­pi­no, ca­ju, ca­fé, fei­jão, al­go­dão e ca­no­la, en­tre ou­tros) em pro­pri­e­da­des da África, Ásia e Amé­ri­ca do Sul. Nos paí­ses ana­li­sa­dos, o ren­di­men­to agrí­co­la cres­ceu de acor­do com a den­si­da­de de po­li­ni­za­do­res, in­di­can­do que a re­du­ção na po­pu­la­ção de abe­lhas e ou­tros in­se­tos po­de­ria ser par­ci­al­men­te res­pon­sá­vel pe­la que­da de pro­du­ti­vi­da­de.

Os re­sul­ta­dos ob­ti­dos com a pes­qui­sa re­la­ta­da aci­ma su­ge­rem que:

a) A pre­sen­ça de in­se­tos nas la­vou­ras po­de ser uma das cau­sas da que­da de pro­du­ti­vi­da­de e bi­o­di­ver­si­da­de.

b) Prá­ti­cas agrí­co­las con­ven­ci­o­nais, com uso de pes­ti­ci­das, fa­vo­re­cem os po­li­ni­za­do­res e au­men­tam a pro­du­ti­vi­da­de.

c) A ado­ção de me­di­das que ofe­re­çam con­di­ções de vi­da mais fa­vo­rá­veis a po­li­ni­za­do­res po­de re­sul­tar em au­men­to de pro­du­ti­vi­da­de do fei­jão.

d) A bi­o­di­ver­si­da­de ob­ser­va­da na África, Ásia e Amé­ri­ca do Sul de­man­da uso in­ten­so de de­fen­si­vos agrí­co­las.

32) Con­si­de­ran­do o es­que­ma a se­guir co­mo uma re­pre­sen­ta­ção sim­pli­fi­ca­da da mei­o­se, in­di­que a al­ter­na­ti­va cor­re­ta.

a) A, B, D e F são di­ploi­des. b) B, C, D e E são for­ma­dos na te­ló­fa­se I. c) A, B, D e G são cé­lu­las idên­ti­cas quan­to ao seu ma­te­ri­al ge­né­ti­co.

d) B, C, D e I são ha­ploi­des.

33) O grá­fi­co a se­guir re­pre­sen­ta a va­ri­a­ção do ín­di­ce gli­cê­mi­co após a in­ges­tão de dois ali­men­tos (mes­ma quan­ti­da­de, pe­la mes­ma pes­soa, mas em mo­men­tos di­fe­ren­tes). A li­nha pon­ti­lha­da re­pre­sen­ta o ali­men­to A, en­quan­to a li­nha con­tí­nua re­pre­sen­ta o ali­men­to B. A aná­li­se do grá­fi­co nos per­mi­te afir­mar cor­re­ta­men­te que:

a) O ali­men­to B não afe­ta a con­cen­tra­ção de gli­co­se na cir­cu­la­ção san­guí­nea.

b) O ali­men­to A não pos­sui car­boi­dra­tos em sua com­po­si­ção.

c) O ali­men­to B aju­da a ema­gre­cer, pois es­ti­mu­la a li­be­ra­ção de adre­na­li­na.

d) O ali­men­to A es­ti­mu­la a li­be­ra­ção de in­su­li­na na cir­cu­la­ção san­guí­nea.

34) O HPV faz par­te do gru­po dos cau­do­ví­rus. As ver­ru­gas ge­ni­tais cau­sa­das pe­la in­fec­ção do ví­rus fo­ram es­tu­da­das des­de a An­ti­gui­da­de, po­rém o ví­rus só foi des­co­ber­to 40 anos atrás. Po­de-se afir­mar cor­re­ta­men­te que:

a) A prin­ci­pal for­ma de se ad­qui­rir o HPV é atra­vés da in­ges­tão de ali­men­tos con­ta­mi­na­dos.

b) O cân­cer de co­lo de úte­ro não po­de ser cau­sa­do pe­lo ví­rus HPV.

c) O ví­rus HPV po­de per­ma­ne­cer la­ten­te por vá­ri­os anos.

d) Não há tra­ta­men­to nem va­ci­na pa­ra o HPV.

35) O cla­do­gra­ma abai­xo re­pre­sen­ta re­la­ções evo­lu­ti­vas en­tre mem­bros da Su­per­fa­mí­lia Ho­mi­noi­dea, on­de se ob­ser­va que

a) ho­mens e gi­bões (Hy­lo­ba­ti­dae) não pos­su­em an­ces­tral co­mum.

b) ho­mens, go­ri­las (Go­ril­la) e oran­go­tan­gos (Pon­go) per­ten­cem a fa­mí­li­as di­fe­ren­tes.

c) ho­mens, gi­bões e chim­pan­zés (Pan) pos­su­em um an­ces­tral co­mum.

d) ho­mens, oran­go­tan­gos (Pon­go) e gi­bões (Hy­lo­ba­ti­dae) são pri­ma­tas per­ten­cen­tes à mes­ma fa­mí­lia.

36) Na vi­da re­al não exis­tem ani­mais que são agen­tes se­cre­tos, mas o or­ni­tor­rin­co, re­pre­sen­ta­do na fi­gu­ra do de­se­nho Phi­ne­as e Ferb, gu­ar­da mui­tos se­gre­dos e cu­ri­o­si­da­des. Es­se ani­mal de apro­xi­ma­da­men­te 60 cm, que pa­re­ce uma mis­tu­ra de lon­tra, pa­to e cas­tor, re­sul­tou em um ser úni­co em vá­ri­os sen­ti­dos.

a) À se­me­lhan­ça dos ma­mí­fe­ros pla­cen­tá­ri­os, a fê­mea do or­ni­to­rin­co ali­men­ta os fi­lho­tes com seu lei­te, mas co­lo­ca ovos.

b) Di­fe­ren­te­men­te dos ma­mí­fe­ros pla­cen­tá­ri­os, os or­ni­tor­rin­cos não pro­du­zem lei­te pa­ra a ali­men­ta­ção dos fi­lho­tes.

c) À se­me­lhan­ça dos ma­mí­fe­ros pla­cen­tá­ri­os, os em­briões dos or­ni­tor­rin­cos ali­men­tam-se ex­clu­si­va­men­te de vi­te­lo acu­mu­la­do no ovo.

d) Di­fe­ren­te­men­te dos ma­mí­fe­ros pla­cen­tá­ri­os, os or­ni­tor­rin­cos apre­sen­tam au­to­fe­cun­da­ção e pro­du­zem ovos.

37) A fi­gu­ra a se­guir ilus­tra frag­men­tos de um ge­ne pre­sen­te em 4 es­pé­ci­es iden­ti­fi­ca­das com os nú­me­ros de 1 a 4 en­tre pa­rên­te­ses. CACTTGTAAAACCAGTATAGACCCTAG (1) CACTTGTAAAACCAGGATAGACGCTAG(2) CACTTGTAAAACCAGTATAGACGCTAG (3) CATTTTTAACACCAGGATAGACGCTAT(4)

As­si­na­le a al­ter­na­ti­va cor­re­ta. a) As es­pé­ci­es 1 e 4 são mais pró­xi­mas en­tre si do que as es­pé­ci­es 1 e 3.

b) As es­pé­ci­es 2 e 3 são mais pró­xi­mas en­tre si do que as es­pé­ci­es 1 e 3.

c) As es­pé­ci­es 1 e 3 são mais pró­xi­mas en­tre si do que as es­pé­ci­es 3 e 4.

d) As es­pé­ci­es 2 e 4 são mais pró­xi­mas en­tre si do que as es­pé­ci­es 1 e 2.

38) O cor­po hu­ma­no é com­pos­to por pe­lo me­nos dois ti­pos de gor­du­ra. A mais co­mum é o te­ci­do adi­po­so branco, um ti­po pe­ri­go­so que se acumula ao re­dor das vís­ce­ras e de­bai­xo da pe­le, po­den­do cau­sar obe­si­da­de e de­sen­ca­de­ar com­pli­ca­ções me­ta­bó­li­cas, co­mo o di­a­be­tes ti­po 2. A ou­tra é o te­ci­do adi­po­so mar­rom, que re­gu­la a pro­du­ção de ca­lor e, con­se­quen­te­men­te, a tem­pe­ra­tu­ra cor­po­ral.

As­si­na­le a al­ter­na­ti­va cor­re­ta. a) O te­ci­do adi­po­so branco pro­duz mais ener­gia que o te­ci­do adi­po­so mar­rom.

b) O te­ci­do adi­po­so mar­rom não pro­duz ATP, mas pro­duz ca­lor.

c) O te­ci­do adi­po­so branco não pro­duz ATP, mas pro­duz ca­lor.

d) O te­ci­do adi­po­so branco pro­duz ATP e ca­lor.

39) Ao ob­ser­var uma cé­lu­la, um pes­qui­sa­dor vi­su­a­li­zou uma es­tru­tu­ra de­li­mi­ta­da por uma du­pla ca­ma­da de mem­bra­na fos­fo­li­pí­di­ca, con­ten­do um sis­te­ma com­ple­xo de en­do­mem­bra­nas re­ple­to de pro­teí­nas in­te­grais e pe­ri­fé­ri­cas. Ve­ri­fi­cou tam­bém que, além de con­ter seu pró­prio ma­te­ri­al ge­né­ti­co, es­sa es­tru­tu­ra ocor­ria em abun­dân­cia em to­das as re­giões me­ris­te­má­ti­cas de plan­tas. Qual se­ria es­sa es­tru­tu­ra celular? a) Clo­ro­plas­to. b) Mi­tocôn­dria. c) Nú­cleo. d) Re­tí­cu­lo en­do­plas­má­ti­co.

ZEWAIL, A. H. Mi­cro­graphia of the twenty-first cen­tury: from ca­me­ra obs­cu­ra to 4D mi­cros­copy. Phi­lo­sophi­cal Tran­sac­ti­ons of the Royal So­ci­ety A,v.368, 2010 (adap­ta­do)

SANDES, A. R. R.; BLASI, G. Bi­o­di­ver­si­da­de e di­ver­si­da­de quí­mi­ca e ge­né­ti­ca. Dis­po­ní­vel em: http:// no­vas­tec­no­lo­gi­as.com.br. Aces­so em: 22 set. 2015(adap­ta­do).(Adap­ta­do de http://re­vis­ta­pes­qui­sa.fa­pesp. br/2016/01/21 /in­se­to­se­le­vam-pro­du­ti­vi­da­de-agri­co­la/)

Newspapers in Portuguese

Newspapers from Brazil

© PressReader. All rights reserved.